Our Services

Get 15% Discount on your First Order

[rank_math_breadcrumb]

L7 form

Follow instruction in the attach form and note to complete the work.

Notes

Structure of Genetic Material

Twenty years after Gregor Mendel studied inheritance patterns in peas and showed that parents passed traits to their offspring in predictable ways, researchers discovered chromosomes. Chromosomes exist in pairs and separate during gamete formation, which led researchers to propose that chromosomes carried the genes for inheritance. A chromosome is made of DNA (deoxyribonucleic acid) and other molecules and proteins, and forms a linear strand of information. Similarly, the genetic codes of DNA itself consist of strands of subunits called nucleotides. Each nucleotide contains a pentose (a 5-carbon sugar) sugar, a phosphate group, and one of four nitrogenous bases: Adenine (A), guanine (G), thymine (T), and cytosine (C), which, ultimately specify the amino acid sequence of various proteins needed in living organisms. Two kinds of nitrogenous bases are present in nucleotides: Purines (A and G bases) and pyrimidines (T and C bases).1

Together, the strands wind around a central axis and form a structure known as a double helix.

DNA can be studied by isolating it from an organism (More on this technique in The DNA Technology section below). Isolated DNA, like DNA inside the nucleus of a cell, is double-stranded, wound tightly around histones, and is present in well-organized condensed matter known as chromosomes. The two strands are bound together by hydrogen bonds that pair the nucleotide guanine (G) with cytosine (C) and the nucleotide adenine (A) with thymine (T).

The complementary nature of the pairs means that a researcher can use a synthetic sequence of nucleotides as a template (blue strand in the image below) to “probe” isolated, naturally-occurring strands of DNA for particular genes. A synthetic DNA probe sequence could be pre-treated with a fluorescent label or radiolabel so that, when the nucleotide bases in the synthetized DNA sequence come into contact with the complementary naturally-occurring sequence (red strand in the image below; will create new one), they would form a paired, double-stranded DNA. The labeled, synthetic DNA sequence is detected by a detector specific for the label (i.e. ultraviolet radiation, autoradiography or chemical sensor).

Why would a researcher want to ‘probe’ DNA?

There are many reasons to study DNA. In this set of laboratory exercises, you will become familiar with a variety of ways to analyze DNA. For example, another term that can be used synonymously with ‘probe’ is ‘marker.’ You may have heard of the BRCA1 marker which is a ‘probe’ for the mutated gene (A mutation is a disruption in the normal sequence of nucleotides A, T, C, G in the gene). The normal, unmutated BRCA1 gene occurs naturally and resides on human chromosome 17. The BRCA1 gene product (a protein) is normally helpful in limiting cell growth by repairing damaged DNA.2 The mutated version of the gene does not code for the usually helpful protein, leaving breast, ovaries, and other tissues in affected women vulnerable to excessive, uncontrolled growth (cancer).

A person might decide to be tested for the gene. The process would entail obtaining a biological sample from the person (such as DNA from a hair sample) then isolating the DNA from that sample. The isolated DNA may then be processed in one of the ways described in the DNA Technology section below and the BRCA1 marker (a sequence of nucleotides complementary to the mutated BRCA1 gene) would be introduced to the isolated DNA sample to determine if the marker pairs (hybridizes) with any DNA sequences in the isolated sample. Hang in there! This will make much more sense as you start to work through the procedures for this laboratory.

Genes, Alleles and Traits

Sequences of nucleotides serve as the genetic basis of life. Long stretches of nucleotides in DNA serve as the blueprint for building every molecule, protein, lipid, carbohydrate and more in living organisms, from bacteria to tomatoes to dolphins. Genes can be defined as sequences of nucleotides that, when processed (more on this later), will result in production of molecules and macromolecules that are essential to structure and function of an organism.

Genes of individual organisms come in limited variations known as the genotype of the individual. For example, there are multiple variations in the DNA nucleotide sequence of the gene for eye color. Physical or behavioral traits, such as variations in eye color or an ability to communicate by sound frequency, are referred to as the phenotype of an individual. There are genes that code for eye color but those genes do not have the exact same DNA nucleotide sequence in every person. A gene for a specific trait is, however, found on the same chromosome in every person and on the same part of the chromosome—unless a person has a chromosomal disorder such as Angelman syndrome (a disorder in which part of the nucleotide sequence is missing—a type of DNA mutation referred to as a deletion).

Gene (Genotype)−→−−−−codes forTrait (Phenotype)Gene (Genotype)→codes forTrait (Phenotype)

The variations in the nucleotide sequence of a gene—such as the multiple blood types A, B, or O—are referred to as alleles of a gene. In the case of blood type, the gene is for blood type and there are three different alleles and you inherit one of the three allele types from each parent. Your blood genotype would, therefore, be either AA, BB, AB, AO, BO, or OO. (Note: In addition, blood type is also identified as positive or negative for the Rh factor antigen which has two major allele types, positive Rh+ or negative Rh−.)

Allele=variation in DNA nucleotide sequence in a specific location on a specific chromosomeAllele=variation in DNA nucleotide sequence in a specific location on a specific chromosome

Central Dogma and Protein Synthesis

How does a non-living molecule like the string of nucleotides in DNA become proteins, lipids, and other macromolecules found in living organisms?

To best answer this question, keep in mind that DNA nucleotide sequences are functional units that serve as a code. Although ensconced safely in the nucleus of eukaryotes, DNA can be operated on to extract its code. Many different enzymes are devoted to extracting the code in DNA. One of the most important extraction processes involves the generation of ribonucleic acid (RNA) as a complementary single-stranded version of DNA gene sequences-a process called transcription. Transcription results in yet another string of non-living nucleotides. The second step toward generating macromolecules and other support materials for living organisms involves translating the code in the newly transcribed RNA (specifically, messenger RNA, mRNA). This phase-called ‘translation’—uses the nucleotides (A,U (uracil), C, G) in mRNA as a three-nucleotide code for amino acids. Gene products (proteins) are synthesized by processing the length of the nucleotides in the transcribed mRNA. Proteins-although not living—serve in multiple roles in living organisms to support growth, homeostasis, responsiveness, and more.

The two-step protein synthesis process-from mRNA transcription to polymerization of amino acids—is referred to as the Central Dogma.

Central Dogma of Life Sciences

Gene (DNA)−→−−−−−−−−transcribed intoMessenger RNA code−→−−−−−−−translated intoAmino acids, proteinsGene (DNA)→transcribed intoMessenger RNA code→translated intoAmino acids, proteins

The example below illustrates this process. Note that only the first few amino acids for a subunit of hemoglobin are shown. 
Individual upper case letters (V, H, L, etc.) shown in the bottom row are the first few amino acids for this subunit of hemoglobin. (V = Valine, H = Histidine, L = Leucine, T = Threonine, P = Proline, E = Glutamate, K = Lysine)

DNA Technology

Once tissue samples are obtained and DNA is isolated, it is in a double-stranded, double-helical configuration. The DNA technologies used in these lab experiments make use of double-stranded and single-stranded DNA. You will gain experience with four DNA analysis methods in this laboratory:

1. DNA segment length measurements

2. DNA sequence/segment length alignment

3. Using DNA probes to search for genes and alleles

4. Constructing DNA sequences

Methods (1) and (2) above can be conducted using either double-stranded or single-stranded DNA. Methods (3) and (4) require single-stranded DNA.

Accessing DNA: Denaturing and Cutting

Double and single strands of DNA occur in nature. DNA spends part of the time as a double helix coiled around histones and wound tightly in chromosomes and the other part of its time as a partial single strand, having its nucleotide base sequences read by various enzymes (See image below, partly separated DNA strands, both strands being read and synthesized in DNA synthesis). In partial or full single-strand mode, nucleotide bases in DNA can be paired with synthetic strings of nucleotide sequences that represent the known sequences of known genes, for example, the nucleotide base sequence of the BRCA1 gene. In this manner, DNA can be analyzed to look for the presence of a specific allele of a gene such the version (allele) of the BRCA1 gene that increases the risk of cancer.

All the DNA analysis methods to be used in this lab will require short segments of DNA to be made from the many long sequences of bases in DNA. This is also a process that involves naturally-occurring enzymes. In this case, the enzymes are restriction endonucleases, or restriction enzymes, for short. These enzymes are complex proteins that cut the DNA strands when specific sequences of nucleotides are encountered. Although cutting only at specific nucleotide sequences, the sequences do not occur in a periodic way or at regular intervals, which means that the cut pieces of DNA will be many different lengths. These various lengths of cut DNA are referred to as DNA fragments.

Method 3 of the analysis that you will conduct requires single-stranded DNA. Isolated DNA can be made single-stranded through exposure to heat. The hydrogen bonds that link the complementary base pairs together, creating the double-stranded configuration, are not heat resistant, which means that exposure to heat causes the two strands of DNA nucleotide bases to separate, becoming single-stranded DNA.

By working with single-stranded DNA, genes present in the DNA can then be ‘probed’ with a synthetic sequence of nucleotide bases complementary to the base sequence appropriate for the gene of interest. The probe would form a double strand with the gene sequence and reveal the presence of the gene in the DNA of this organism (as shown in the image below).

Method 4 of the DNA analysis that you will conduct involves reconstruction of the original DNA sequence. This is possible by adding free-floating nucleotide bases to a mixture that contains the isolated, single-stranded DNA as well as an enzyme that polymerizes (builds) DNA strands. The newly synthesized strand will be complementary to the DNA strands in the mixture.

The trick in Method 4 is that some of the A, T, G, and C nucleotides have been altered so that they will not permit the addition of an additional nucleotide. This means the new double strands will vary in length—just like the original DNA fragments in Method 2.

There are three significant twists in Method 4.

1. A proportion of the nucleotides are chemically altered to prevent further nucleotides from being added, thus restricting the length of the newly synthesized, complementary strand

2. The altered nucleotides (known as dideoxynucleotides) are tagged or labeled in a similar manner to a gene probe or marker (as in Method 2)

3. Each nucleotide (A, T, G, and C) is analyzed separately from the other three nucleotides

Electrophoresis as a DNA Analysis Tool

As noted above, in this set of experiments, you will learn how to analyze DNA using four distinct methods. The four methods of analysis can be conducted on the same analytic device called an electrophoresis instrument. For working with biological macromolecules like DNA, the instrument is configured with a dense, gel-like polymer matrix, an aqueous, charge-conducting buffer, and an electric field is applied across the matrix/buffer. A power source is connected to the gel matrix/buffer and configured so that a negative charge (black lead in the image above) is applied to one end of the matrix and a positive charge (red lead in the image above) at the other end. Samples are loaded into wells containing phosphorescent dye (green). This dye makes the DNA samples visible in the dark.

Because the gel matrix is densely populated with polymers and acts as a sieve, DNA fragments will migrate according to size (length of the segment/number of nucleotide bases). Larger strands move slower due to more encounters with obstacles within the matrix. Since nucleic acids are negatively charged, they will be repulsed by the negatively charged end of the instrument and be attracted by the positive end, which is the basis for the direction of movement down each lane of the electrophoresis instrument. The image above shows the final result of a data run for five DNA samples.

Now that you have a sense of how electrophoresis can be used as a DNA analysis tool, let’s return again to the four methods for this laboratory.

Procedure I Overview: DNA segment length measurements

Being able to separate DNA fragments is an important step in DNA technology using electrophoresis. This first experiment gives you experience with running the electrophoresis experiment and determining the relative location and size of each fragment. Keep in mind that smaller (shorter) DNA fragments migrate faster through the matrix/buffer than larger (longer) ones so the shorter fragments will move farther from the starting, negative end of the instrument during the time of the experimental run.

Procedures II and III Overview: DNA sequence/segment length alignment

Forensics analysis and paternity tests are often showcased in TV series and movies. Most times, a viewer gains very little insight into the technical or scientific basis of the tests. In these procedures, you will get the opportunity to conduct these tests and draw conclusions about the findings. For both types of tests, you will compare the appropriate lanes of the electrophoresis image to make decisions about a crime scene analysis and a paternity case.

Tip: A ruler may be helpful when attempting to match up DNA fragments in the gel (a bank/ATM/credit card works well too).

Procedure III Overview: Using DNA probes to search for genes and alleles

The use of genetic analysis is a multi-billion dollar industry and impacts society in a manner that has almost become accepted without question, with influences that range from common foods in grocery stores to requesting information about family ancestry.

Essentially, these multi-billion dollar industries are ‘probing’ genes and making associations between genes (and/or alleles) and traits. For example, if a scientist in a biotechnology industry discovers a plant that thrives in drought conditions (trait), s/he conducts the necessary DNA analysis to find the exact gene or genes that give rise to that trait. After locating the gene, the scientist can sequence that gene (Procedure IV) and insert it into the genome of other plants which gives them the new trait of drought tolerance.

In Procedure III, you will conduct a second part of the paternity test. You will explore whether the baby carries a specific allele (variation in the nucleotide sequence of a gene) that the father carries. This type of analysis is called a Southern blot. After the DNA fragments have been separated by length (first image above) a special ‘filter’ is applied to the gel. This filter contains a ‘probe’ and a white phosphorescent dye that will attach only to a specific allele. In the second image above we see that the probe has identified the DNA in lane 2 (first fragment) as having the allele in question.

Procedure IV Overview: Constructing DNA sequences

By conducting a DNA sequence analysis, you are effectively performing the same kind of experiment that was responsible for determining the human genome in 2001.3 Being able to identify the nucleotide sequences of DNA is the first step to being able to identify different types of DNA sequences such as codes for genes and many other non-coding regions of nucleotides in DNA. Additionally, the sequences of those nucleotides also reveal clues about the evolutionary history of the organisms. For example, if two nucleotide sequences from two different organisms (i.e., from two different species) are very similar, the similarity suggests that the two organisms likely evolved from a common ancestor.

Confirm that the reconstructed sequence from below is: TGCGCATCAGT — remember to start from the shortest fragment. It may be helpful to use a ruler when attempting to match up DNA fragments in the gel, or in this case, to determine the order of the fragments. A bank/ATM/credit card works well too.

Summary of Formulas Needed for Calculations

Example: Compute percent alignment between a nucleotide sequence from a recently discovered species with nucleotide sequences from two different, known species.

Sequence data:

Recently obtained sequence (62 nucleotides) from a newly discovered, unknown species of plant:

ATCGCTAAATGGCCTTAGCTAGTCACTTTGATCGATCGATCGATGCTAGACTGCTAGATCGA

Nucleotide sequence of known Plant A:

ATCGCTATCTGGCCTTAGCTAGTCACTTTGATCGATCGATGGATGCTAGACTGCTAGGTCGA

Nucleotide sequence of known Plant B:

ATCGCTAAGATGCCTTAGCTAGTCACTTTGAGATCTCGATCGATGCTAGACTGCTGAGTCGA

Align the sequences: Unknown with Plant A (differences in the Plant A sequence are highlighted)

ATCGCTAAATGGCCTTAGCTAGTCACTTTGATCGATCGATCGATGCTAGACTGCTAGATCGA
ATCGCTATCTGGCCTTAGCTAGTCACTTTGATCGATCGATGGATGCTAGACTGCTAGGTCGA

There are 4 differences between the sequences, therefore

Percent alignment=100%×number of nucleotides alignednumber of nucleotides in sequencePercent alignment=100%×number of nucleotides alignednumber of nucleotides in sequence

Percent alignment=100%×5862=93.55%Percent alignment=100%×5862=93.55%

Align the sequences: Unknown with Plant B (differences in the Plant B sequence are highlighted)

ATCGCTAAATGGCCTTAGCTAGTCACTTTGATCGATCGATCGATGCTAGACTGCTAGATCGA
ATCGCTAAGATGCCTTAGCTAGTCACTTTGAGATCTCGATCGATGCTAGACTGCTGAGTCGA

There are 10 differences between the sequences, therefore

Percent alignment=100%×number of nucleotides alignednumber of nucleotides in sequencePercent alignment=100%×number of nucleotides alignednumber of nucleotides in sequence

Percent alignment=100%×5262=83.87%

image6.png

image1.png

image2.png

image3.png

image4.png

image5.png

Share This Post

Email
WhatsApp
Facebook
Twitter
LinkedIn
Pinterest
Reddit

Order a Similar Paper and get 15% Discount on your First Order

Related Questions

MS 2

Milestone Two Template BIO 212: Microbiology Name: Title of your presentation: What type of software or application will you be using for your final presentation (PowerPoint, PowerPoint with voice-over, etc.)? Outline Complete the sections with short sentences or sentence fragments. You should provide enough information to show that you have

HIMS 645 D3

  Imagine you have been hired as a data quality manager by a local healthcare facility (define your choice of a facility) that has not yet had any healthcare data quality policy. You were tasked to develop it.  Discuss the role of healthcare data quality policy in your chosen organization

FAN

FIN 5130 Mini-case 1 Real-world Application: Risk and Return Dr. Darshana Palkar Page 1 of 3 This assignment will require you to analyze time series of monthly returns of different securities. [5 points] 1) Pick FOUR companies as follows from Yahoo! Finance website: i. For each company of your choice,

Species

See attached Species: Harpia harpyja; Kemp’s ridley turtle BIO 330 Milestone One Guidelines and Rubric For this milestone, submit a literature review and indicate the species you have selected for your final project. The literature review must address the critical elements listed below and must include at least four primary and

HIMS 645 ASS 2

COVID-19 pandemic gravely affected the entire world. Being a pandemic, the outbreak required monitoring the infection rate both at the national and international levels. Which agencies collected COVID-19 related information nationally and internationally and by what method(s)? Were the methods used the same or different? Why? Assess the role of

HIMS 645 D1

 Two types of data contained in healthcare databases are Primary and Secondary depending on their sources. Pick a Healthcare organization (offer its description in 2-3 sentences). Identify the sources of primary and secondary data collected and used in that organization. Which of these sources and types of data is more reliable

HIMS 655 D2

  As a health Information management (HIM) manager, you have been assigned to review a Physicians’ documentation for completeness of a patient’s health record in EHR. Which elements of the documentation would you look for in the health record and what is the rationale for your selection of these elements?

Help

AHS1650-2 Procedural Coding Competency Checklist Name: ____________________________Date: ____________________________Score: ________________ AHS1650-2 Perform Procedural C Performance Objective: The student will be able to properly codes procedures using the current CPT manual including CPT sections anesthesia, surgery, pathology and laboratory, medicine, and radiology. Task: Locate CPT codes in sections anesthesia, surgery, pathology and

HIMS 655 ASS1

  Electronic Health Record (EHR) is a computer application for recording and retrieving patient information by authorized individuals.  However, authorized individuals can perform only the allowed activities with EHR – view, add, modify, update, and delete information based on their level of access configured through permissions.  If you are working

Biology Assignment 3

Click on the method names below to download a sample Excel spreadsheet displaying each. Averaging Download Averaging Averaging with Seasonality Download Averaging with Seasonality Exponential Smoothing Download Exponential Smoothing Exponential Smoothing with Seasonality Download Exponential Smoothing with Seasonality Exponential Smoothing with Trend Download Exponential Smoothing with Trend Exponential Smoothing with

Biology Homework

NGM2 — NGM2 TASK 1: PRACTICE IMPROVEMENT PLAN PROPOSAL ORGANIZATIONAL SYSTEMS AND HEALTHCARE TRANSFORMATION — D221 PRFA — NGM2 COMPETENCIES 738.4.1 : Compare Healthcare Delivery Models The learner compares healthcare delivery models to facilitate value-based care, shared decision-making, and equitable patient-centered care. 738.4.2 : Describe Continuous Improvement Strategies The learner

Case

Individual Case Study – Instructions (Descriptive Analysis) For the Descriptive Analysis Project, follow the instructions in the  Correlation Case Study Instructions  Download Correlation Case Study Instructions  using this data file  Pattern Recognition Data (student)  Download Pattern Recognition Data (student) .  You may use your own data for this project as

Week 8 forum post

  When we take good look at the families around us today it’s clear they are diverse. There’s an increase in single-parent, gay and lesbian, grandparent, blended family, and nontraditional households. It’s clear that the family plays a huge role in a child’s development. That being said, think about your

AP

See attachment. Case Study – Capital Investment Decisions  Bethesda Mining is a midsized coal mining company with 20 mines located in Ohio, Pennsylvania, West Virginia, and Kentucky. The company operates deep mines as well as strip mines. Most of the coal mined is sold under contract, with excess production sold

Forensic Biology Case Study Analysis

Provide a comprehensive analysis of the “Tales from the grave” article. Give a brief outline of the case and describe the biological elements that helped solve the case. Analyze how DNA science was used in cooperation with traditional investigative principles to solve the case. Using this Article: Gunasekera, R.S., A.B.